Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311298

Morpholino Name: fzd8 MO4
Synonyms: TNeu087g20, Xtfrizzled8, frizzled8
mRNA Target: fzd8

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGCTGCACGGCTCCACTCACAGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGCTGTGAGTGGAGCCGTGCAGCAT 3' | ||||||||||||||||||||||| 3' TTGACACTCACCTCGGCACGTCGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr6:21483680..21483704 24/25 Antisense target fzd8
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers