Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311301

Morpholino Name: fzd10 MO3
Synonyms: TGas025k08, Xtfrizzled9/10a.2, frizzled10
mRNA Target: fzd10

Morpholino Type:
Sequence:
5' CGGGCTGATAGCGAATGACTGGAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GCTCCAGCCATTCGCTATCAGCCCG 3' ||||||| ||||||||||||||||| 3' CGAGGTCAGTAAGCGATAGTCGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12518:13175574-13175598 21/25 unknown
Scaffold211559:293457-293481 21/25 unknown
tropicalis 7.1 scaffold_1:49767928-49767952 24/25 Antisense target fzd10
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556