Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311306

Morpholino Name: hoxb3 MO1
Synonyms: TNeu134e01, XthoxB3
mRNA Target: hoxb3

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCATAGTAGGATGCTTTCTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' ATGCAGAAAGCATCCTACTATGACA 3' ||||||||||||||||||||||||| 3' TACGTCTTTCGTAGGATGATACTGT 5' 5' ATGCAGAAAGCCTCCTATTATGACA 3' ||||||||||| ||||| ||||||| 3' TACGTCTTTCGTAGGATGATACTGT 5' 5' ATGCAGAAAGCCTCCTACTATGACA 3' ||||||||||| ||||||||||||| 3' TACGTCTTTCGTAGGATGATACTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:3109832..3109856 24/25 Antisense target hoxb3.S
chr9_10S:3109832..3109856 24/25 Sense off-target LOC108702522
chr9_10L:3473968..3473992 23/25 Antisense target hoxb3.L
tropicalis 10.0 Chr10:12027901..12027925 25/25 Antisense target hoxb3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers