Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311308

Morpholino Name: hoxd1 MO3
Synonyms: TNeu039b14, XtHoxD1
mRNA Target: hoxd1

Morpholino Type:
Sequence:
5' AATTCATCTCTAGGGAGACTTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' GAGAAGTCTCCCTAGAGATGAATT 3' |||||||||||||||||||||||| 3' CTCTTCAGAGGGATCTCTACTTAA 5' 5' GAGAAGTCTCCCTAGAGATGAATT 3' |||||||||||||||||||||||| 3' CTCTTCAGAGGGATCTCTACTTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4321:5050495-5050518 24/24 Antisense target hoxd1.S
Scaffold5895:5261509-5261532 21/24 unknown
Scaffold98999:228334-228357 21/24 Antisense off-target Xelaev16080757m
tropicalis 7.1 scaffold_9:20757873-20757896 24/24 Antisense target hoxd1
scaffold_4:16425314-16425337 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556