Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311308

Morpholino Name: hoxd1 MO3
Synonyms: TNeu039b14, XtHoxD1
mRNA Target: hoxd1

Morpholino Type: uncategorized morpholino
Sequence:
5' AATTCATCTCTAGGGAGACTTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' GAGAAGTCTCCCTAGAGATGAATT 3' |||||||||||||||||||||||| 3' CTCTTCAGAGGGATCTCTACTTAA 5' 5' GAGAAGTCTCCCTAGAGATGAATT 3' |||||||||||||||||||||||| 3' CTCTTCAGAGGGATCTCTACTTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:62164020..62164043 24/24 Antisense target hoxd1.S
chr1L:94476291..94476314 21/24 unknown
chr4L:54904173..54904196 21/24 Antisense off-target banp.L
tropicalis 10.0 Chr9:65133931..65133954 24/24 Antisense target hoxd1
Chr4:16769708..16769731 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers