Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311309

Morpholino Name: cbx1 MO1
Synonyms: TEgg130i17, XtHP1b
mRNA Target: cbx1

Morpholino Type:
Sequence:
5' TTTCTTGTTCTGCTTCTTTCCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGGGAAAGAAGCAGAACAAGAAA 3' ||||||||||||||||||||||||| 3' GTACCCTTTCTTCGTCTTGTTCTTT 5' 5' CATGGGAAAGAAGCAGAACAAGAAA 3' ||||||||||||||||||||||||| 3' GTACCCTTTCTTCGTCTTGTTCTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:1833049..1833073 25/25 Antisense target cbx1.S
Scaffold75417:4587274..4587298 25/25 Antisense off-target Xelaev16071962m
Scaffold71264:1498487..1498511 22/25 unknown
Scaffold110275:177681..177705 21/25 unknown
Scaffold12518:4523573..4523597 21/25 Antisense off-target Xelaev16007112m
Scaffold137507:2833647..2833671 21/25 unknown
Scaffold25196:455854..455878 21/25 unknown
Scaffold259992:2020..2044 21/25 unknown
Scaffold271293:35071..35095 21/25 Antisense off-target Xelaev16036958m
Scaffold32212:7195813..7195837 21/25 unknown
Scaffold326837:99277..99301 21/25 Sense off-target Xelaev16043473m
Scaffold337349:216303..216327 21/25 unknown
Scaffold373158:430319..430343 21/25 unknown
Scaffold395611:37925..37949 21/25 unknown
Scaffold52573:8545786..8545810 21/25 unknown
Scaffold66475:2231274..2231298 21/25 unknown
tropicalis 7.1 scaffold_10:29251705..29251729 25/25 Antisense target cbx1
scaffold_1:177521265..177521289 21/25 unknown
scaffold_2:12634737..12634761 21/25 Antisense off-target luzp1
scaffold_2:70618526..70618550 21/25 unknown
scaffold_34:473167..473191 21/25 unknown
scaffold_34:521842..521866 21/25 unknown
scaffold_34:592118..592142 21/25 unknown
scaffold_5:64475002..64475026 21/25 unknown
scaffold_6:32894848..32894872 21/25 Antisense off-target ca8
scaffold_6:62668570..62668594 21/25 unknown
scaffold_7:26607510..26607534 21/25 unknown
scaffold_8:100822720..100822744 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556