Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311310

Morpholino Name: dnali1 MO1
Synonyms: TNeu100n17, Xthp28aDLC
mRNA Target: dnali1

Morpholino Type:
Sequence:
5' ATCATGTTGAGCGATTCACAGATAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 21/25
genomic

MO
5' GTAGCTGTGAATCGCTCAACATGAT 3' || ||||||||||||||||||||| 3' TATAGACACTTAGCGAGTTGTACTA 5' 5' ACACCTGTGCTTCGCTCAACATGAT 3' | | ||||| |||||||||||||| 3' TATAGACACTTAGCGAGTTGTACTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29016:1744145-1744169 21/25 Sense off-target Xelaev16039212m
Scaffold344404:32-56 21/25 unknown
Scaffold345631:909372-909396 21/25 Sense off-target Xelaev16045451m
Scaffold360703:385915-385939 21/25 Antisense target dnali1.S
Scaffold52573:10628205-10628229 21/25 Sense off-target Xelaev16060461m
Scaffold84584:260598-260622 21/25 Sense off-target dvl3.L
tropicalis 7.1 scaffold_2:8385460-8385484 23/25 Antisense target dnali1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556