Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311311

Morpholino Name: ing3 MO1
Synonyms: TNeu023p18, XtIng3-prov
mRNA Target: ing3

Morpholino Type:
Sequence:
5' CCAGATAATCCTCCAGGTACAACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGTTGTACCTGGAGGATTATCTGG 3' ||||||||||||||||||||||||| 3' TACAACATGGACCTCCTAATAGACC 5' 5' ATGCTGTACTTGGAGGATTATCTGG 3' ||| ||||| ||||||||||||||| 3' TACAACATGGACCTCCTAATAGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold152894:2388871-2388895 23/25 Antisense off-target Xelaev16015335m
Scaffold26505:956673-956697 23/25 Antisense target ing3.L
Scaffold129797:2059544-2059568 21/25 Antisense off-target Xelaev16008559m
Scaffold44546:1475661-1475685 21/25 Antisense off-target Xelaev16054886m
Scaffold48559:143058-143082 21/25 unknown
tropicalis 7.1 scaffold_3:97842938-97842962 25/25 Antisense target ing3
scaffold_3:62482745-62482769 21/25 Antisense off-target prmt8
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556