Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311312

Morpholino Name: ing5 MO1
Synonyms: TGas087m13, XtING5
mRNA Target: ing5

Morpholino Type:
Sequence:
5' CTCTAGGTACATCGCCGTCGCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGGCGACGGCGATGTACCTAGAG 3' ||||||||||||||||||||||||| 3' GTACCGCTGCCGCTACATGGATCTC 5' 5' CATGGCGACGGCGATGTACCTAGAG 3' ||||||||||||||||||||||||| 3' GTACCGCTGCCGCTACATGGATCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold376454:645899..645923 25/25 Antisense target ing5.L
Scaffold16807:10645521..10645545 24/25 Antisense off-target Xelaev16019629m
tropicalis 7.1 scaffold_9:45179424..45179448 25/25 Antisense target ing5
scaffold_10:18642200..18642224 21/25 Sense off-target nags
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556