Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311313

Morpholino Name: itgb1 MO3
Synonyms: TEgg135f07, Xtintegrinbeta1
mRNA Target: itgb1

Morpholino Type:
Sequence:
5' ACGTCAATACTGAATAACGGGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGGCCCGTTATTCAGTATTGACGT 3' ||||||||||||||||||||||||| 3' TACCGGGCAATAAGTCATAACTGCA 5' 5' ATGGCCCGTTATCCAGTATTCACGT 3' |||||||||||| ||||||| |||| 3' TACCGGGCAATAAGTCATAACTGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold52573:4532739-4532763 23/25 Antisense target itgb1.S
tropicalis 7.1 scaffold_6:122552331-122552355 25/25 Antisense target itgb1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556