Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311335

Morpholino Name: lzts2 MO1
Synonyms: TEgg129e23, XtLAPSER1
mRNA Target: lzts2

Morpholino Type:
Sequence:
5' CTAGCAAGGCAGCCATAGTGTAGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 21/25
genomic

MO
5' ATCTACACTATGGCTGCCTTGCAAG 3' |||||||||||||||||||||| || 3' TAGATGTGATACCGACGGAACGATC 5' 5' ATCTACACTATGGCTGCAGTACAAG 3' ||||||||||||||||| | | || 3' TAGATGTGATACCGACGGAACGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:124217-124241 21/25 Antisense target lzts2.S
Scaffold20754:91534-91558 21/25 Sense off-target Xelaev16026862m
Scaffold4321:699330-699354 21/25 unknown
tropicalis 7.1 scaffold_7:24347749-24347773 24/25 Antisense target lzts2
scaffold_2:99853150-99853174 21/25 unknown
scaffold_7:90773124-90773148 21/25 unknown
scaffold_9:78609035-78609059 21/25 unknown
scaffold_9:79684022-79684046 21/25 Antisense off-target rbbp6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556