Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311336

Morpholino Name: lefty MO8
Synonyms: Lefty-b, TGas031a08, XtLeftyBlike
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' CACCCATCTTGCTGTGACAGTGATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATCACTGTCACAGCAAGATGGGTG 3' ||||||||||||||||||||||||| 3' CTAGTGACAGTGTCGTTCTACCCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:94955247..94955271 22/25 unknown
chr1L:54560813..54560837 21/25 unknown
chr1S:49818260..49818284 21/25 unknown
chr2S:69458023..69458047 21/25 unknown
chr5S:53331608..53331632 21/25 unknown
chr8L:52937890..52937914 21/25 Sense off-target ly6g6d.L
tropicalis 10.0 Chr5:8257847..8257871 25/25 Antisense target lefty
Chr5:72290911..72290935 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers