Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311337

Morpholino Name: lhx1 MO2
Synonyms: Lim 1, TGas028k15, XtLim1
mRNA Target: lhx1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCGCATCCAGCACAGTGAACCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' AATGGTTCACTGTGCTGGATGCGAA 3' |||||||||||||||||||||||| 3' GTACCAAGTGACACGACCTACGCTT 5' 5' AATGGTTCACTGTGCTGGATGCGAA 3' |||||||||||||||||||||||| 3' GTACCAAGTGACACGACCTACGCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27891:1831172..1831196 24/25 Antisense off-target Xelaev16038234m
Scaffold3412:1149255..1149279 24/25 Antisense target lhx1.L
Scaffold15436:1270940..1270964 21/25 unknown
tropicalis 7.1 scaffold_2:83643831..83643855 24/25 Antisense target lhx1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556