Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311338

Morpholino Name: ap1m2 MO1
Synonyms: Mu1a, TTbA033a09, XtM1b
mRNA Target: ap1m2

Morpholino Type:
Sequence:
5' ATATACACGGCGGAGGCTGACATAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GTATGTCAGCCTCCGCCGTGTATAT 3' ||||||||||||||||||||||||| 3' CATACAGTCGGAGGCGGCACATATA 5' 5' GTATGTCAGCCTCCGCTGTGTTTAT 3' |||||||||||||||| |||| ||| 3' CATACAGTCGGAGGCGGCACATATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18726:699623..699647 23/25 Antisense target ap1m2.L
Scaffold82179:719006..719030 22/25 Antisense off-target Xelaev16075265m
tropicalis 7.1 scaffold_24:343973..343997 25/25 Antisense target ap1m2
scaffold_94:76171..76195 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556