Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311345

Morpholino Name: c19orf52 MO2
Synonyms: TGas128o11, xtnovel1.2
mRNA Target: timm29

Morpholino Type:
Sequence:
5' CGCCTTCCGCCAGCTCTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

MO
5' TGCAGAGCTGGCGGAAGGCG 3' |||||||||||||||||||| 3' ACGTCTCGACCGCCTTCCGC 5' 5' TGCAGAGCTGGCGGAAGACG 3' ||||||||||||||||| || 3' ACGTCTCGACCGCCTTCCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold82179:225430-225449 19/20 Antisense target timm29.S
Scaffold23403:1546554-1546573 18/20 unknown
Scaffold60618:1967291-1967310 18/20 Antisense off-target Xelaev16065757m
Scaffold126925:10-29 16/20 unknown
Scaffold18192:582998-583017 16/20 Sense off-target Xelaev16022395m
Scaffold79772:5147123-5147142 16/20 Sense off-target znf384.L
tropicalis 7.1 scaffold_24:958073-958092 20/20 Antisense target timm29
scaffold_7:38697469-38697488 16/20 unknown
scaffold_7:7203547-7203566 16/20 Sense off-target znf384
scaffold_7:7205595-7205614 16/20 Sense off-target znf384
scaffold_7:7209531-7209550 16/20 Sense off-target znf384
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556