Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311348

Morpholino Name: znf674 MO1
Synonyms: TGas106k21, Xtnovel12
mRNA Target: znf674

Morpholino Type:
Sequence:
5' CATGGCCGCGCTCTCTCCCGGCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GCGCCGGGAGAGAGCGCGGCCATG 3' |||||||||||||||||||||||| 3' CGCGGCCCTCTCTCGCGCCGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:145340651..145340674 24/24 Antisense target znf674
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556