Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311365

Morpholino Name: ccdc174 MO1
Synonyms: TGas055a16, Xtnovel 16
mRNA Target: ccdc174

Morpholino Type:
Sequence:
5' CTAGCGGCTTCTTCTTCCTGTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGGACAGGAAGAAGAAGCTGCTGG 3' ||||||||||||||||||| ||| | 3' TACCTGTCCTTCTTCTTCGGCGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7281:2312660-2312684 23/25 Antisense target ccdc174.S
Scaffold163806:1996462-1996486 21/25 unknown
Scaffold58517:4768517-4768541 21/25 Sense off-target Xelaev16063984m
tropicalis 7.1 scaffold_4:124346223-124346247 25/25 Antisense off-target ccdc174
scaffold_4:137410678-137410702 21/25 Sense off-target dnah12
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556