Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311369

Morpholino Name: sccpdh MO1
Synonyms: TGas139h15, Xtnovel19
mRNA Target: sccpdh

Morpholino Type:
Sequence:
5' GCGCTCTGTCGCCATAGTAACTGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CGCAGTTACTATGGCGACAGAGCGC 3' ||||||||||||||||||||||||| 3' GCGTCAATGATACCGCTGTCTCGCG 5' 5' CGCAGTTACCATGGCGACAGAGCGT 3' ||||||||| |||||||||||||| 3' GCGTCAATGATACCGCTGTCTCGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold176005:1536606-1536630 23/25 Antisense off-target sccpdh.2.L
Scaffold34423:1111555-1111579 23/25 Antisense target sccpdh.S
Scaffold16807:2662314-2662338 21/25 unknown
Scaffold76000:192654-192678 21/25 unknown
tropicalis 7.1 scaffold_5:74237437-74237461 25/25 Antisense target sccpdh
scaffold_5:79548510-79548534 25/25 Antisense off-target sccpdh.2
scaffold_7:41021929-41021953 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556