Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311371

Morpholino Name: ap5s1 MO1
Synonyms: Sex comb on midleg homolog 1, TGas118b19, Xtnovel20
mRNA Target: ap5s1

Morpholino Type:
Sequence:
5' TGTGAATAACAAAGCCATAAACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGTTTATGGCTTTGTTATTCACA 3' ||||||||||||||||||||||||| 3' TACCAAATACCGAAACAATAAGTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27067:1144464-1144488 25/25 Antisense target ap5s1.L
Scaffold154892:267810-267834 22/25 unknown
Scaffold83691:769951-769975 22/25 unknown
Scaffold112610:570894-570918 21/25 Antisense off-target Xelaev16003447m
Scaffold1168:3388377-3388401 21/25 unknown
Scaffold12518:424825-424849 21/25 Antisense off-target Xelaev16006917m
Scaffold203187:846502-846526 21/25 unknown
Scaffold245044:276951-276975 21/25 unknown
Scaffold27036:10656307-10656331 21/25 unknown
Scaffold402746:2462835-2462859 21/25 Antisense off-target Xelaev16051529m
Scaffold55571:1699210-1699234 21/25 unknown
Scaffold57216:1790444-1790468 21/25 Antisense off-target Xelaev16062905m
Scaffold7479:1683456-1683480 21/25 Antisense off-target Xelaev16071407m
tropicalis 7.1 scaffold_7:60928419-60928443 25/25 Antisense off-target ap5s1
scaffold_1:27616285-27616309 21/25 Antisense off-target edil3
scaffold_3:106581663-106581687 21/25 Antisense off-target ccdc146
scaffold_6:114834875-114834899 21/25 unknown
scaffold_8:69494830-69494854 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556