Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311390

Morpholino Name: otog MO3
Synonyms: TNeu069g20, Xtnovel23.2
mRNA Target: otogl

Morpholino Type:
Sequence:
5' GTTCTAGCCACAGTGGAACCACACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold56777:547644..547668 22/25 Antisense off-target Xelaev16062536m
tropicalis 7.1 scaffold_7:104647111..104647135 25/25 unknown
scaffold_7:37651595..37651619 21/25 Antisense off-target osbp
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556