Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311395

Morpholino Name: tmem70 MO1
Synonyms: TNeu097d01, Xtnovel28
mRNA Target: tmem70

Morpholino Type:
Sequence:
5' CGGGCTCCTCAGGCTCACTCACACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTGTGAGTGAGCCTGAGGAGCCCG 3' ||||||||||||||||||||||||| 3' ACACACTCACTCGGACTCCTCGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11063:1663593-1663617 22/25 unknown
Scaffold18192:2764142-2764166 21/25 unknown
Scaffold52573:12611237-12611261 21/25 Sense off-target Xelaev16060493m
tropicalis 7.1 scaffold_6:28359333-28359357 25/25 Antisense target tmem70
scaffold_1197:4190-4214 23/25 unknown
scaffold_1197:4479-4503 23/25 unknown
scaffold_1197:4624-4648 23/25 unknown
scaffold_1197:4661-4685 23/25 unknown
scaffold_1197:4698-4722 23/25 unknown
scaffold_1197:4735-4759 23/25 unknown
scaffold_1197:4772-4796 23/25 unknown
scaffold_1197:4809-4833 23/25 unknown
scaffold_1197:5026-5050 23/25 unknown
scaffold_1197:5063-5087 23/25 unknown
scaffold_1197:5100-5124 23/25 unknown
scaffold_1197:5209-5233 23/25 unknown
scaffold_1197:5318-5342 22/25 unknown
scaffold_1197:4335-4359 21/25 unknown
scaffold_1197:4371-4395 21/25 unknown
scaffold_1197:4407-4431 21/25 unknown
scaffold_1197:4516-4540 21/25 unknown
scaffold_1197:4552-4576 21/25 unknown
scaffold_1197:4846-4870 21/25 unknown
scaffold_1197:4882-4906 21/25 unknown
scaffold_1197:4954-4978 21/25 unknown
scaffold_1197:5173-5197 21/25 unknown
scaffold_1197:5246-5270 21/25 unknown
scaffold_1197:5282-5306 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556