Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311402

Morpholino Name: fam73b
Synonyms: TNeu129e04, Xtnovel33
mRNA Target: miga2

Morpholino Type:
Sequence:
5' CCTCTGCTCTCTGAAATGCCATAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GCTATGGCATTTCAGAGAGCAGAGG 3' ||||||||||||||||||||||||| 3' CGATACCGTAAAGTCTCTCGTCTCC 5' 5' GCGATGGCGTTTCAGAGAGCAGAGG 3' || ||||| |||||||||||||||| 3' CGATACCGTAAAGTCTCTCGTCTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold91655:415756-415780 23/25 Antisense target miga2.L
Scaffold13787:2432146-2432170 22/25 Antisense off-target ikzf2.L
Scaffold20345:1738069-1738093 22/25 Sense off-target Xelaev16026188m
Scaffold231070:147-171 22/25 unknown
Scaffold14978:8084961-8084985 21/25 unknown
Scaffold268711:1311319-1311343 21/25 Sense off-target Xelaev16036383m
Scaffold72014:400218-400242 21/25 unknown
Scaffold79166:828925-828949 21/25 unknown
Scaffold83691:2230386-2230410 21/25 unknown
Scaffold99272:310-334 21/25 unknown
tropicalis 7.1 scaffold_8:7343570-7343594 25/25 Antisense target miga2
scaffold_173:111441-111465 23/25 unknown
scaffold_6:94809330-94809354 22/25 unknown
scaffold_168:200073-200097 21/25 unknown
scaffold_168:72618-72642 21/25 unknown
scaffold_175:57805-57829 21/25 unknown
scaffold_2:17500233-17500257 21/25 unknown
scaffold_4:69088717-69088741 21/25 Sense off-target lmo4.1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556