Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311403

Morpholino Name: hmgn2 MO2
Synonyms: HMG17, TNeu136h04, Xtnovel35
mRNA Target: hmgn2

Morpholino Type:
Sequence:
5' CCATCAGCCTTTCTCTTGGGCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold189815:717-741 21/25 unknown
Scaffold278628:15114-15138 21/25 unknown
Scaffold37448:1075249-1075273 21/25 Sense off-target Xelaev16048835m
Scaffold5269:3636307-3636331 21/25 unknown
Scaffold53837:120-144 21/25 unknown
Scaffold98463:518720-518744 21/25 unknown
tropicalis 7.1 scaffold_2:147433037-147433061 21/25 unknown
scaffold_2:147433170-147433194 21/25 unknown
scaffold_7:37301871-37301895 21/25 Sense off-target slc43a1
scaffold_7:9271428-9271452 21/25 unknown
scaffold_9:12008654-12008678 21/25 unknown
scaffold_9:35674648-35674672 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556