Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311405

Morpholino Name: rtfdc1 MO2
Synonyms: TNeu018d13, Xtnovel36.2
mRNA Target: rtfdc1

Morpholino Type:
Sequence:
5' GTTTAGTCAGTCACCAAAACAAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold112554:1473338-1473361 20/24 unknown
Scaffold112899:184556-184579 20/24 unknown
Scaffold261090:107208-107231 20/24 unknown
Scaffold278088:43529-43552 20/24 unknown
Scaffold62355:555298-555321 20/24 unknown
Scaffold67962:901323-901346 20/24 unknown
Scaffold69443:7363665-7363688 20/24 Sense off-target Xelaev16068975m
Scaffold7546:1637979-1638002 20/24 Antisense off-target Xelaev16072273m
tropicalis 7.1 scaffold_10:35441475-35441498 23/24 Antisense off-target rtfdc1
scaffold_7:3334534-3334557 20/24 Antisense off-target ddrgk1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556