Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311410

Morpholino Name: ubtd2 MO1
Synonyms: TGas076c07, Xtnovel4
mRNA Target: ubtd2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGAGTGCCCACACACCCTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGGGAGGGTGTGTGGGCACTCACC 3' ||||||||||||||||||||||||| 3' TACCCTCCCACACACCCGTGAGTGG 5' 5' ATGGGAGGGTGTGTGGGAACTCACC 3' ||||||||||||||||| ||||||| 3' TACCCTCCCACACACCCGTGAGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18892:3467136..3467160 25/25 Antisense off-target Xelaev16023732m
Scaffold40421:1685178..1685202 24/25 Antisense target ubtd2.S
Scaffold22127:480351..480375 21/25 unknown
tropicalis 7.1 scaffold_3:69805690..69805714 25/25 Antisense target ubtd2
scaffold_8:55478365..55478389 22/25 unknown
scaffold_4:129713477..129713501 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556