Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311412

Morpholino Name: sugt1 MO2
Synonyms: TNeu104f22, Xtnovel41
mRNA Target: sugt1

Morpholino Type:
Sequence:
5' AACAGCTCTCTCTGTCATGTTTATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATAAACATGACAGAGAGAGCTGTT 3' ||||||||||||||||||||||||| 3' GTATTTGTACTGTCTCTCTCGACAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14692:7180759-7180783 22/25 Antisense off-target Xelaev16013911m
Scaffold11136:2321989-2322013 21/25 Antisense off-target Xelaev16002842m
Scaffold245044:2818913-2818937 21/25 Sense off-target Xelaev16032649m
Scaffold26819:2088460-2088484 21/25 unknown
Scaffold32212:978191-978215 21/25 unknown
Scaffold338390:895212-895236 21/25 Sense off-target Xelaev16044555m
Scaffold36600:427907-427931 21/25 unknown
Scaffold49688:995914-995938 21/25 unknown
Scaffold52441:3724000-3724024 21/25 Antisense off-target npr3.L
Scaffold96659:2455642-2455666 21/25 Sense off-target Xelaev16079923m
tropicalis 7.1 scaffold_2:73858600-73858624 25/25 Antisense target sugt1
scaffold_6:26262839-26262863 21/25 unknown
scaffold_6:28203931-28203955 21/25 Sense off-target gdap1
scaffold_7:67086875-67086899 21/25 unknown
scaffold_804:22163-22187 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556