Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311419

Morpholino Name: ubn2 MO1
Synonyms: TEgg140p11, Xtnovel47
mRNA Target: ubn2

Morpholino Type:
Sequence:
5' CGGCTCCGCCATTCCTTCCTCTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GAGAGAGGGAGGAATGGCGGAGCCG 3' |||||||| |||||||||||||||| 3' CTCTCTCCTTCCTTACCGCCTCGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold245044:6233445-6233469 24/25 Antisense off-target Xelaev16032756m
Scaffold23165:4778826-4778850 21/25 Antisense off-target Xelaev16030281m
Scaffold73623:731142-731166 21/25 unknown
Scaffold74261:747864-747888 21/25 unknown
Scaffold7546:336587-336611 21/25 Antisense off-target Xelaev16072232m
tropicalis 7.1 scaffold_4:79516895-79516919 24/25 Antisense target ubn2
scaffold_3667:5040-5064 21/25 unknown
scaffold_8:41825125-41825149 21/25 Antisense off-target sytl4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556