Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311421

Morpholino Name: acbd6 MO1
Synonyms: TEgg003f20, Xtnovel48
mRNA Target: acbd6

Morpholino Type:
Sequence:
5' CATGGCTGCTGACTCTCGCACTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 21/24
genomic

MO
5' CTAGTGCGAGAGTCAGCAGCCATG 3' |||||||||||||||||||||||| 3' GATCACGCTCTCAGTCGTCGGTAC 5' 5' TTAGTGCGAGGGACAGCAGCCATG 3' ||||||||| | ||||||||||| 3' GATCACGCTCTCAGTCGTCGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:8010956..8010979 22/24 unknown
Scaffold69443:9345139..9345162 21/24 Antisense target acbd6.S
Scaffold11701:947593..947616 20/24 unknown
tropicalis 7.1 scaffold_4:110866731..110866754 24/24 Antisense target acbd6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556