Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311425

Morpholino Name: c1orf131 MO1
Synonyms: TGas141c24, Xtnovel5
mRNA Target: c1orf131

Morpholino Type:
Sequence:
5' GATCTCGTTCTGCCATATTAGAGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGCTCTAATATGGCAGAACGAGATC 3' ||||||||||||||||||||||||| 3' GCGAGATTATACCGTCTTGCTCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold174427:21902-21926 22/25 Antisense off-target Xelaev16020923m
Scaffold58049:2355960-2355984 21/25 Sense off-target Xelaev16063695m
tropicalis 7.1 scaffold_5:73030021-73030045 25/25 Antisense target c1orf131
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556