Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311427

Morpholino Name: ncaph2 MO2
Synonyms: TEgg019e13, Xtnovel50.2
mRNA Target: ncaph2

Morpholino Type:
Sequence:
5' TTTTCTTTACTGAAGGTATGTGCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' AGGCACATACCTTCAGTAAAGTGAG 3' ||||||||||||||||||||| | 3' TCCGTGTATGGAAGTCATTTCTTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15893:6842235-6842259 21/25 unknown
Scaffold203041:3988467-3988491 21/25 unknown
Scaffold43483:3874098-3874122 21/25 unknown
Scaffold52441:10837998-10838022 21/25 unknown
Scaffold89040:1235149-1235173 21/25 unknown
tropicalis 7.1 scaffold_3:116813820-116813844 22/25 Antisense target ncaph2
scaffold_10:5047640-5047664 21/25 Sense off-target tmem104
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556