Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311428

Morpholino Name: rcbtb2 MO1
Synonyms: TEgg066c16, Xtnovel52
mRNA Target: rcbtb2

Morpholino Type:
Sequence:
5' GCCATTTTCCAACATCCACCATTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ACAATGGTGGATGTTGGAAAATGGC 3' ||||||||||||||||||||||||| 3' TGTTACCACCTACAACCTTTTACCG 5' 5' AAAATGGTGGATGTTGGAAAATGGC 3' | ||||||||||||||||||||||| 3' TGTTACCACCTACAACCTTTTACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8129:5088912-5088936 24/25 Antisense target rcbtb2.S
Scaffold43242:1534744-1534768 22/25 unknown
Scaffold51452:2307447-2307471 22/25 Sense off-target prlr.S
Scaffold138921:776684-776708 21/25 unknown
Scaffold140858:936252-936276 21/25 Antisense off-target Xelaev16012617m
Scaffold16001:6608550-6608574 21/25 Antisense off-target rfc1.L
Scaffold2511:1984234-1984258 21/25 Sense off-target Xelaev16033462m
Scaffold26505:1673468-1673492 21/25 unknown
Scaffold29769:1275023-1275047 21/25 Sense off-target Xelaev16039842m
Scaffold33905:150236-150260 21/25 unknown
Scaffold39723:1946424-1946448 21/25 Antisense off-target Xelaev16050586m
Scaffold5732:10158011-10158035 21/25 Antisense off-target rcbtb1.S
Scaffold59267:1497054-1497078 21/25 Sense off-target fgfr1.S
Scaffold74339:1532668-1532692 21/25 unknown
Scaffold9528:1402768-1402792 21/25 Antisense off-target Xelaev16079743m
tropicalis 7.1 scaffold_2:76636160-76636184 25/25 Antisense target rcbtb2
scaffold_1:191704272-191704296 21/25 unknown
scaffold_4:17655080-17655104 21/25 Antisense off-target pax6
scaffold_4:51464046-51464070 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556