Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311433

Morpholino Name: zufsp MO1
Synonyms: TNeu109g23, Xtnovel57
mRNA Target: zufsp

Morpholino Type:
Sequence:
5' AGTGCAGATGTCACAAATAAGCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' CATGCTCATTTGTGACATCTGCACT 3' |||||| |||||||||||||||||| 3' GTACGAATAAACACTGTAGACGTGA 5' 5' CATGTTTATTTGTGACATCTGCACT 3' |||| |||||||||||||||||||| 3' GTACGAATAAACACTGTAGACGTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold873:2021370-2021394 24/25 Antisense target zufsp.S
Scaffold131854:2044757-2044781 21/25 unknown
Scaffold197721:712917-712941 21/25 Antisense off-target Xelaev16025083m
Scaffold275342:2998783-2998807 21/25 Antisense off-target Xelaev16037820m
tropicalis 7.1 scaffold_5:53386468-53386492 25/25 unknown
scaffold_5:52822961-52822985 24/25 Antisense target zufsp
scaffold_2:76979810-76979834 21/25 unknown
scaffold_52:51377-51401 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556