Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311434

Morpholino Name: tceanc2 MO1
Synonyms: TEgg006f18, Xtnovel58
mRNA Target: tceanc2

Morpholino Type:
Sequence:
5' CTTCCTGATTACAAATCTGTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGGACAGATTTGTAATCAGGAAG 3' ||||||||||||||||||||||||| 3' CTACCTGTCTAAACATTAGTCCTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold69443:5977857..5977881 24/25 Sense off-target Xelaev16068925m
Scaffold53263:3352772..3352796 22/25 unknown
Scaffold11199:3079761..3079785 21/25 unknown
Scaffold151039:634619..634643 21/25 unknown
Scaffold20345:2284459..2284483 21/25 unknown
Scaffold22127:2728873..2728897 21/25 Sense off-target Xelaev16028927m
Scaffold27891:1100715..1100739 21/25 Antisense off-target Xelaev16038215m
Scaffold35086:50017..50041 21/25 Antisense off-target Xelaev16046030m
Scaffold8006:1109815..1109839 21/25 Sense off-target epb41l3.L
tropicalis 7.1 scaffold_4:107353051..107353075 25/25 Antisense target tceanc2
scaffold_1:178649253..178649277 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556