Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311440

Morpholino Name: mga MO1
Synonyms: TEgg085b11, Xtnoveltbox
mRNA Target: mga

Morpholino Type:
Sequence:
5' GGTTTCTCCATGATTGTTAATTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CAAATTAACAATCATGGAGAAACC 3' |||||||||||||||||||||||| 3' GTTTAATTGTTAGTACCTCTTTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold175547:1403683-1403706 21/24 unknown
Scaffold160942:916437-916460 20/24 unknown
Scaffold29940:1415548-1415571 20/24 Sense off-target ntf3.S
tropicalis 7.1 scaffold_8:84123448-84123471 24/24 Antisense target mga
scaffold_2:57776974-57776997 21/24 unknown
scaffold_8:98786100-98786123 21/24 unknown
scaffold_3:111274267-111274290 20/24 unknown
scaffold_4:41735328-41735351 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556