Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311441

Morpholino Name: mga MO2
Synonyms: TEgg085b11, Xtnoveltbox.2
mRNA Target: mga

Morpholino Type:
Sequence:
5' GATGGATTCTGCAACTCAAAATAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATTATTTTGAGTTGCAGAATCCATC 3' ||||||||||||||||||||||||| 3' TAATAAAACTCAACGTCTTAGGTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7479:1968071..1968095 22/25 Sense off-target gabpb1.S
Scaffold100253:2062937..2062961 21/25 Sense off-target Xelaev16000077m
Scaffold107347:1683499..1683523 21/25 unknown
Scaffold187321:5604996..5605020 21/25 unknown
Scaffold33905:1097713..1097737 21/25 Sense off-target mbtps1.L
Scaffold40886:442118..442142 21/25 unknown
Scaffold40963:801755..801779 21/25 unknown
Scaffold52441:7103637..7103661 21/25 Antisense off-target Xelaev16060161m
Scaffold60608:3088998..3089022 21/25 unknown
tropicalis 7.1 scaffold_8:84123474..84123498 25/25 Antisense target mga
scaffold_3:21222246..21222270 22/25 Sense off-target gabpb1
scaffold_7:47648767..47648791 22/25 Antisense off-target sh2d4b
scaffold_2:6341675..6341699 21/25 Sense off-target ptpru
scaffold_2:68698178..68698202 21/25 unknown
scaffold_5:29613988..29614012 21/25 Sense off-target myt1l
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556