Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311442

Morpholino Name: pdss2 MO1
Synonyms: TEgg098o12, XtnovelTS
mRNA Target: pdss2

Morpholino Type:
Sequence:
5' AGGCACTGGCAAATCAAAGCCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8355:3700747..3700771 23/25 Antisense off-target Xelaev16075547m
Scaffold364815:19139..19163 22/25 unknown
Scaffold402161:150487..150511 22/25 unknown
Scaffold12020:5799402..5799426 21/25 Antisense off-target b3gnt2.L
Scaffold14692:6275610..6275634 21/25 Sense off-target neil3.L
Scaffold15893:2077804..2077828 21/25 unknown
tropicalis 7.1 scaffold_5:48809939..48809963 25/25 unknown
scaffold_2:142856249..142856273 21/25 Sense off-target glra2
scaffold_3:84792267..84792291 21/25 unknown
scaffold_4:123714901..123714925 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556