Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311443

Morpholino Name: nodal1 MO7
Synonyms: TGas124h10, Xtnr1, nr1
mRNA Target: nodal1

Morpholino Type:
Sequence:
5' CAGGACTGCTGTCAGAAATGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GATGGCATTTCTGACAGCAGTCCTG 3' ||||||||||||||||||||||||| 3' CTACCGTAAAGACTGTCGTCAGGAC 5' 5' CATGGCATTTCTGACAGCAGTCCTG 3' |||||||||||||||||||||||| 3' CTACCGTAAAGACTGTCGTCAGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210561-210585 24/25 Antisense target nodal1.L
Scaffold59267:2177697-2177721 24/25 Antisense off-target Xelaev16065126m
Scaffold137879:83239-83263 22/25 Antisense off-target lamp2.S
Scaffold61124:6676824-6676848 22/25 unknown
Scaffold122317:764-788 21/25 unknown
Scaffold196047:68-92 21/25 unknown
Scaffold282487:11869-11893 21/25 unknown
Scaffold36864:4105509-4105533 21/25 Antisense off-target Xelaev16047989m
Scaffold47457:64960-64984 21/25 Antisense off-target dvl1.L
Scaffold54451:1152-1176 21/25 unknown
Scaffold57216:105618-105642 21/25 unknown
Scaffold8129:6068182-6068206 21/25 unknown
tropicalis 7.1 scaffold_3:5678105-5678129 25/25 Antisense target nodal1
scaffold_6:110650308-110650332 22/25 unknown
scaffold_8:22407928-22407952 21/25 Antisense off-target hsf3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556