Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311443

Morpholino Name: nodal1 MO7
Synonyms: TGas124h10, Xtnr1, nr1
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGGACTGCTGTCAGAAATGCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' GATGGCATTTCTGACAGCAGTCCTG 3' ||||||||||||||||||||||||| 3' CTACCGTAAAGACTGTCGTCAGGAC 5' 5' CATGGCATTTCTGACAGCAGTCCTG 3' |||||||||||||||||||||||| 3' CTACCGTAAAGACTGTCGTCAGGAC 5' 5' CATGGCATTTCTGACAGCAGTCCTG 3' |||||||||||||||||||||||| 3' CTACCGTAAAGACTGTCGTCAGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376067..125376091 24/25 Antisense target nodal1.L
chr3S:20865471..20865495 24/25 Antisense target nodal1.S
chr3L:125376067..125376091 24/25 Sense off-target star.L
chr8S:56065020..56065044 22/25 Antisense off-target lamp2.S
Scaffold309:1534..1558 21/25 Antisense off-target LOC108705658 [provisional:hsf3]
Scaffold309:20448..20472 21/25 Antisense off-target hsf3.1
chr7L:87064626..87064650 21/25 Antisense off-target dvl1.L
chr8L:13268822..13268846 21/25 Antisense off-target LOC108698253 [provisional:hsf3]
chr6L:32278796..32278820 22/25 unknown
Scaffold6472:86..110 21/25 unknown
chr2S:118514961..118514985 21/25 unknown
chr6S:27028482..27028506 21/25 unknown
tropicalis 10.0 Chr3:132122715..132122739 25/25 Antisense target nodal1
Chr6:34752588..34752612 22/25 Sense off-target nxph1
Chr8:40811680..40811704 21/25 Sense off-target ngrn
Chr8:40811680..40811704 21/25 Antisense off-target hsf3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers