Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311444

Morpholino Name: nodal1 MO8
Synonyms: TGas124h10, Xtnr1.2, nr1
mRNA Target: nodal1

Morpholino Type:
Sequence:
5' CTTGTGCTGCTGTTCTCTCTCTTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCAAGAGAGAGAACAGCAGCACAAG 3' ||||||||||||||||||||||||| 3' CGTTCTCTCTCTTGTCGTCGTGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold173125:617541..617565 22/25 unknown
Scaffold397522:175..199 22/25 unknown
Scaffold54274:858608..858632 22/25 Sense off-target Xelaev16061742m
Scaffold106356:1929767..1929791 21/25 unknown
Scaffold15436:3498482..3498506 21/25 Sense off-target Xelaev16015695m
Scaffold253809:583275..583299 21/25 Antisense off-target Xelaev16034116m
Scaffold39437:3487955..3487979 21/25 Sense off-target Xelaev16050122m
Scaffold46492:1218128..1218152 21/25 Sense off-target Xelaev16056214m
Scaffold90041:4239995..4240019 21/25 unknown
Scaffold97703:1161692..1161716 21/25 Antisense off-target ufd1.S
tropicalis 7.1 scaffold_3:5678130..5678154 25/25 Antisense target nodal1
scaffold_6:4693363..4693387 21/25 unknown
scaffold_7:7129852..7129876 21/25 Sense off-target iffo1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556