Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311444

Morpholino Name: nodal1 MO8
Synonyms: TGas124h10, Xtnr1.2, nr1
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGTGCTGCTGTTCTCTCTCTTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCAAGAGAGAGAACAGCAGCACAAG 3' ||||||||||||||||||||||||| 3' CGTTCTCTCTCTTGTCGTCGTGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:83798524..83798548 22/25 Sense off-target tcf3.S
chr1S:127273113..127273137 21/25 Antisense off-target ufd1.S
chr3S:59673069..59673093 21/25 Antisense off-target myo9a.S
chr8S:64017585..64017609 21/25 Sense off-target mamld1.S
chr8S:97715888..97715912 21/25 Sense off-target crtc2.S
chr1L:95227907..95227931 21/25 Sense off-target tcf3.L
chr1L:16978834..16978858 21/25 Sense off-target sorcs2.L
Scaffold35230:175..199 22/25 unknown
Scaffold53:630731..630755 22/25 unknown
chr1L:114063565..114063589 21/25 unknown
tropicalis 10.0 Chr3:132122690..132122714 25/25 Antisense target nodal1
Chr7:10027542..10027566 21/25 Sense off-target iffo1
Chr9:90503525..90503549 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers