Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311447

Morpholino Name: nodal3.1 MO3
Synonyms: TGas097d22, Xtnr3.2
mRNA Target: nodal3.1

Morpholino Type:
Sequence:
5' CAAGAAGAGGCTGAGGAAGGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GATGGCCTTTCTCAGCCTCTTCTTG 3' ||||||||| ||||||||||||||| 3' CTACCGGAAGGAGTCGGAGAAGAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_3:5700413-5700437 25/25 Antisense target nodal3.1
scaffold_3:5713390-5713414 25/25 Antisense target nodal3.1
scaffold_3:5718872-5718896 25/25 Antisense target nodal3.1
scaffold_3:5705330-5705354 24/25 Antisense target nodal3.1
scaffold_3:5705330-5705354 24/25 Antisense off-target nodal3.2
scaffold_1:128917727-128917751 21/25 unknown
scaffold_3:38504623-38504647 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556