Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311448

Morpholino Name: loc100144286 MO1
Synonyms: OA1, TGas030h04, XtOA1
mRNA Target: loc100144286

Morpholino Type:
Sequence:
5' TTCTGGGCAAGTGCACTGATGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGGCATCAGTGCGCTTGCCCAGAA 3' ||||||||||||| ||||||||||| 3' TACCGTAGTCACGTGAACGGGTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36991:1393857-1393881 24/25 Antisense target loc100144286.L
Scaffold157205:645356-645380 21/25 unknown
Scaffold202158:70753-70777 21/25 unknown
Scaffold21603:9442456-9442480 21/25 Antisense off-target tnfaip6.L
Scaffold404817:327328-327352 21/25 unknown
Scaffold79772:2345230-2345254 21/25 Sense off-target bicc1.L
Scaffold8006:218957-218981 21/25 unknown
Scaffold91271:384087-384111 21/25 Sense off-target Xelaev16078295m
tropicalis 7.1 scaffold_8:24798684-24798708 25/25 Antisense off-target loc100144286
scaffold_1:99320851-99320875 22/25 unknown
scaffold_1:25287992-25288016 21/25 unknown
scaffold_107:116896-116920 21/25 unknown
scaffold_6:49425024-49425048 21/25 unknown
scaffold_8:54624883-54624907 21/25 Sense off-target unnamed
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556