Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311449

Morpholino Name: otx2 MO3
Synonyms: TGas114a06
mRNA Target: otx2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGTTGCTTGAGATAAGACATCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGATGTCTTATCTCAAGCAACCG 3' ||||||||||||||||||||||||| 3' GTACTACAGAATAGAGTTCGTTGGC 5' 5' CATGATGTCTTATCTCAAGCAACCG 3' ||||||||||||||||||||||||| 3' GTACTACAGAATAGAGTTCGTTGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133644:1772019..1772043 25/25 Antisense off-target Xelaev16009780m
Scaffold91950:415490..415514 25/25 Antisense target otx2.L
tropicalis 7.1 scaffold_8:83088503..83088527 25/25 Antisense target otx2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556