Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311453

Morpholino Name: mark2 MO4
Synonyms: Xtpar1, par1
mRNA Target: mark2

Morpholino Type:
Sequence:
5' CTTTGCTGCTATATCCTCCAACATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGTTGGAGGATATAGCAGCAAAG 3' ||||||||||||||||||||||||| 3' CTACAACCTCCTATATCGTCGTTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2589:1149004-1149028 24/25 Antisense off-target Xelaev16034955m
Scaffold31469:1861573-1861597 23/25 Antisense off-target Xelaev16042174m
Scaffold51452:5910147-5910171 22/25 unknown
Scaffold13576:5216607-5216631 21/25 unknown
Scaffold24597:21478-21502 21/25 Antisense off-target Xelaev16032907m
Scaffold293841:715597-715621 21/25 Sense off-target Xelaev16039422m
tropicalis 7.1 scaffold_54:207197-207221 25/25 Antisense target mark2
scaffold_1:168945706-168945730 21/25 unknown
scaffold_2:54939870-54939894 21/25 Sense off-target ddx3x
scaffold_6:86244112-86244136 21/25 Antisense off-target golga4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556