Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311454

Morpholino Name: pard3b MO1
Synonyms: Par3B, TEgg004p11, XtPar3
mRNA Target: pard3b

Morpholino Type:
Sequence:
5' TCCCAAAGCAAACGGTTACTTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20345:5137289..5137313 25/25 Antisense off-target Xelaev16026284m
Scaffold139113:328515..328539 24/25 Antisense off-target Xelaev16012061m
Scaffold24235:4357608..4357632 21/25 unknown
Scaffold33876:432638..432662 21/25 Sense off-target Xelaev16044630m
Scaffold33905:1959636..1959660 21/25 Antisense off-target Xelaev16044727m
Scaffold5895:475390..475414 21/25 unknown
Scaffold9266:11269699..11269723 21/25 unknown
tropicalis 7.1 scaffold_9:26782366..26782390 25/25 unknown
scaffold_2:122840391..122840415 21/25 unknown
scaffold_2:36911521..36911545 21/25 Sense off-target atp2a3
scaffold_2:65538335..65538359 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556