Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311455

Morpholino Name: pard6g MO1
Synonyms: PAR6A, TNeu123j18, XtPar6A
mRNA Target: pard6g

Morpholino Type:
Sequence:
5' GGACTTACTGAAGCTGCGGTTCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GATGAACCGCAGCTTTAGTAAGTCC 3' ||||||||||||||| ||||||||| 3' CTACTTGGCGTCGAAGTCATTCAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold206980:69947-69971 24/25 Antisense target pard6g.S
Scaffold73623:739551-739575 24/25 Antisense off-target Xelaev16070707m
Scaffold12518:13815753-13815777 22/25 Sense off-target Xelaev16007431m
tropicalis 7.1 scaffold_6:51502766-51502790 25/25 unknown
scaffold_6:816701-816725 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556