Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311459

Morpholino Name: rac1 MO2
Synonyms: TEgg073l16, XtRac1
mRNA Target: rac1

Morpholino Type:
Sequence:
5' GACCACACATTTAATGGCCTGCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CATGCAGGCCATTAAATGTGTGGTC 3' ||||||||||||||||||||||||| 3' GTACGTCCGGTAATTTACACACCAG 5' 5' CATGCAGGCCATTAAATGTGTGGTG 3' |||||||||||||||||||||||| 3' GTACGTCCGGTAATTTACACACCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23403:7625606..7625630 24/25 unknown
Scaffold9994:12579301..12579325 24/25 Antisense target rac1.L
Scaffold109184:561787..561811 22/25 Antisense off-target Xelaev16002214m
Scaffold122517:382014..382038 22/25 Antisense off-target Xelaev16006140m
Scaffold166365:498543..498567 21/25 unknown
Scaffold78978:6079305..6079329 21/25 unknown
Scaffold81267:1728222..1728246 21/25 unknown
tropicalis 7.1 scaffold_9:74314512..74314536 25/25 Antisense target rac1
scaffold_4:84574299..84574323 22/25 Antisense off-target rac2
scaffold_7:88146220..88146244 22/25 Antisense off-target cdc42
scaffold_10:12329941..12329965 21/25 unknown
scaffold_2:41746792..41746816 21/25 Sense off-target sgsm2
scaffold_7:112360465..112360489 21/25 Antisense off-target rac3
scaffold_7:49288759..49288783 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556