Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311460

Morpholino Name: rad51 MO1
Synonyms: TEgg126n13, XtRad51
mRNA Target: rad51

Morpholino Type:
Sequence:
5' TCCTCTTCTGTGGCTTCTGCTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGAAGCAGAAGCCACAGAAGAGGA 3' ||||||||||||||||||||||||| 3' TACTTCGTCTTCGGTGTCTTCTCCT 5' 5' ATCAAGCAGAAGCCACAGAAGAAGA 3' || ||||||||||||||||||| || 3' TACTTCGTCTTCGGTGTCTTCTCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold218195:3474833..3474857 23/25 Antisense target rad51.S
Scaffold221007:54750..54774 22/25 unknown
Scaffold371381:117..141 22/25 unknown
Scaffold380214:376..400 22/25 unknown
Scaffold44061:1250651..1250675 22/25 unknown
Scaffold51206:123067..123091 22/25 Sense off-target Xelaev16058885m
Scaffold99319:727838..727862 22/25 unknown
Scaffold139113:1642494..1642518 21/25 unknown
Scaffold155165:242..266 21/25 unknown
Scaffold167347:1860689..1860713 21/25 unknown
Scaffold18726:432741..432765 21/25 unknown
Scaffold25463:1011768..1011792 21/25 unknown
Scaffold265143:27499..27523 21/25 unknown
Scaffold338390:2039719..2039743 21/25 unknown
Scaffold39203:561019..561043 21/25 unknown
Scaffold52341:5311885..5311909 21/25 Antisense off-target Xelaev16059936m
Scaffold52702:4935608..4935632 21/25 unknown
Scaffold59965:1090209..1090233 21/25 Antisense off-target Xelaev16065438m
Scaffold67669:1111288..1111312 21/25 Sense off-target Xelaev16068182m
tropicalis 7.1 scaffold_8:94486482..94486506 25/25 Antisense target rad51
scaffold_4:98464016..98464040 21/25 unknown
scaffold_6:9129695..9129719 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556