Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311466

Morpholino Name: elk4 MO2
Synonyms: LIG8D09, XtSAP1
mRNA Target: elk4

Morpholino Type:
Sequence:
5' CTTGCTATGGACAGTGCTATTACTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 26/26 25/26 24/26
genomic

MO
5' AAAGTAATAGCACTGTCCATAGCAAG 3' |||||||||||||||||||||||||| 3' TTTCATTATCGTGACAGGTATCGTTC 5' 5' AAAGTAATAGCACTATCCATAGCAAG 3' |||||||||||||| ||||||||||| 3' TTTCATTATCGTGACAGGTATCGTTC 5' 5' AAAGTGATAGCACTATCCATAGCAAG 3' ||||| |||||||| ||||||||||| 3' TTTCATTATCGTGACAGGTATCGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2841:1869667-1869692 25/26 Sense target elk4.L
Scaffold138050:1107530-1107555 24/26 Sense target elk4.S
Scaffold45681:126083-126108 22/26 unknown
tropicalis 7.1 scaffold_1:68272226-68272251 26/26 Sense target elk4
scaffold_4:137027031-137027056 22/26 unknown
scaffold_4:15686496-15686521 22/26 unknown
scaffold_6:51719718-51719743 22/26 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556