Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311467

Morpholino Name: serpina3 MO1
Synonyms: Serpina1, TTpA011h07, Xtserpin-related1
mRNA Target: serpina3

Morpholino Type:
Sequence:
5' CAAAATGTAAGGAAGACCCCTCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGAGGGGTCTTCCTTACATTTTG 3' ||||||||||||||||||||||||| 3' CTACTCCCCAGAAGGAATGTAAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold33269:992676-992700 21/25 Sense off-target Xelaev16044124m
Scaffold352190:893376-893400 21/25 Sense off-target Xelaev16046243m
Scaffold51966:176832-176856 21/25 Antisense off-target Xelaev16059402m
Scaffold52441:5031400-5031424 21/25 unknown
tropicalis 7.1 scaffold_8:62285132-62285156 25/25 Antisense target serpina3
scaffold_757:18482-18506 21/25 unknown
scaffold_757:18588-18612 21/25 unknown
scaffold_9:71810268-71810292 21/25 Antisense off-target prkar1b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556