Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311469

Morpholino Name: skida1 MO1
Synonyms: Dachshund2-like with gill expression, TGas128i12, Xtski/sno domain
mRNA Target: skida1

Morpholino Type:
Sequence:
5' TTAAAGCCTCCTGCTCCATTAGTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' CGCTAAATGGAGCAGGAGGCTTTAA 3' | |||||||||||||||||||| 3' GGTGATTACCTCGTCCTCCGAAATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43483:4752174-4752198 22/25 unknown
Scaffold52573:680177-680201 21/25 Antisense target skida1.S
tropicalis 7.1 scaffold_6:118266254-118266278 25/25 Antisense off-target skida1
scaffold_1:79068902-79068926 21/25 unknown
scaffold_3:105131438-105131462 21/25 Sense off-target pik3cg
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556